4.7.2 Sequences for TEM gene

> TEM SAMPLE-1                    403

We Will Write a Custom Essay Specifically
For You For Only $13.90/page!


order now

GGGTAAATAAAGATTGCTGAAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGAAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACAATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGT

> TEM SAMPLE-2                757

CGCGAACCCACTGAAGCTAGGATATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAACATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGGATGAACGAAATAGACAGATCGCTGAAGATAGGAT

> TEM SAMPLE-3             603 

GTTGAAGTAAAGGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGCATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTATCAGTGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTAT

> TEM SAMPLE-4                        761

CGAAGAAAGCACTGCTGAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGGATGAACGAAATAGACAGATCGCTGAGATAGGTGGGGAGGGGA

>
TEM SAMPLE-5                       757

       
CGATTAGTAAGGATGCTGAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTTGGAGATAGGACGGG

 

4.7.3 Sequences for CTX-M gene

> CTX-M  SAMPLE-1                 752     

TGTCATCACTCTTTTTTGTGCTGAGTGTTGTCCGAGCATGTCTGTTAATCAGCAAGTTGACATCCATCATCTGACCTTGTTAACTATAATCCGATTGCGGAAATGCTGAACAATGGGACGATGTCAGTGGCTGAGCTTAGCGCGGCCGCGCTTTATTTTGAGATAACGTGTGCATGAATAAGCTGATTGCTCACGTTGGTTGCCCGGCTAAAGTCACCTTATTCTCCCGACCTCTGTTACACCAAGTTTTCCATCTCGACCGTACCGACTGGACGTTAAACACCGCCATTCCGGGCGATCCGCGTGATACCACTTCTCCTCGGGTTTCGTGTCACACTCGGCCTAATCTGACTTTGGGGAAAGCATTGGGTGATGCCAACGGGCGCAGCTGGTGACATGAATGATTGGCGATAGCACCGGTGCATGTTTGATTCGGGCGGGACTGCCTGCTTCCTGGGTTGCGTTGGATAAAACCGGCATCTGATGAAAAGAAAAAATTGATGTCAAAATGTGATGGTTGCTATGAGCGTGTCGCCCAAGGTATGAAACCGGTCTGTGTTGAATCTTGTCCACAACGTGCACTGGATTTTGATGATATTGAAGTGATCAGAGCGAAACATGGTACAGAGTGTGGTATCGCACCAATGCCAGATCCGGCTTAACTGACCCAAATATCGTGATAAAGCACATAAGGATGCAATACCTTCCGGTGATAAACCGGCACCACGTTTTGATGTCTAGTGATTTCGAAT

> CTX-M  SAMPLE-2                 679                   

GTAGAGAGCAGGATGCTGAGAAGTGAGCGAACCGAATCTGTTAAATCAGCGAGTTGAGATCAAAAAATCTGACCTTGTTAACTATAATCCGATTGCGGAAAAGCACGTCAATGGGACGATGTCACTGGCTGAGCTTAGCGCGGCCGCGCTACAGTACAGCGATAACGTGGCGATGAATAAGCTGATTGCTCACGTTGGCGGCCCGGCTAGCGTCACCGCGTTCGCCCGACAGCTGGGAGACGAAACGTTCCGTCTCGACCGTACCGAGCCGACGTTAAACACCGCCATTCCGGGCGATCCGCGTGATACCACTTCACCTCGGGCAATGGCGCAAACTCTGCGGAATCTGACGCTGGGTAAAGCATTGGGCGACAGCCAACGGGCGCAGCTGGTGACATGGATGAAAGGCAATACCACCGGTGCAGCGAGCATTCAGGCTGGACTGCCTGCTTCCTGGGTTGTGGGGGATAAAACCGGCAGCAGATAATAAAACTGATTGATGTCAAAATGGGATGTTTGCTATTAACTTGTTGCCCAAGGTATGGCACGTGTCTGTGTTGAATCTTGTCCACAACGTGCACTGTATTTTGGATGATATTGAAGTGATCAGAGCGAACAGGGTACAGAAGTGTGGGATCGCCCCGGGCCAGATCCAAGCTTAAGTAACCCAAATAGCCGG

> CTX-M  SAMPLE-3                        235

GATAAAGAAAAGGTCTGAGAAGTGAAGCGAACCGAATCTGTTAAATCAGCGAGTTGAGATCAAAAAATCTGATTTGTTAACTATAATCCGATTGCGGAAAAGCACGTCAATGGGATGATGTCGCTGGCTGAGCTTAGCGCGGCCGCGCTACAGTACAGCGATAACGTGGCGGTAAATAAGCTGATTGCTCCTCCCGGGGGAGGGGCAAACGACAATAGTTAGAAGAGAGAGGGGA

4.7.4 Sequences for qnrS gene

> qnrS  SAMPLE-1                                           452

GGTTCGGTTTACCGAGGACGGGTGATATCGAAGGCTGCCACTTTGATGTCGCAGATCTTCGTGATGCAAGTTTCCAACAATGCCAACTTGCGATGGCAAACTTCAGTAATGCCAATTGCTACGGTATAGAGTTCCGTGCGTGTGATTTAAAAGGTGCCAACTTTTCCCGAACAAACTTTGCCCATCAAGTGAGTAATCGTATGTACTTTTGCTCAGCATTTATTTCTGGATGTAATCTTTCCTATGCCAATATGGAGAGGGTTTGTTTAGAAAAATGTGAGTTGTTTGAAAATCGCTGGATAGGAACGAACCTAGCGGGTGCATCACTGAAAGAGTCAGACTTAAGTCGAGGTGTTTTTTCCGAAGATGTCTGGGGGCAATTTAGCCTACAGGGTGCCAATTTATGCCACGCCGAACTCGACGGTTTAGATCACGCAAGTTAGCACGTCACA

> qnrS  SAMPLE-2                                        457

GTTTGGGTACGATCACATCGACAGGGTGATATCGAGGCTGCCACTTTGATGTCGCAGATCTTCGTGATGCAAGTTTCCAACAATGCCAACTTGCGATGGCAAACTTCAGTAATGCCAATTGCTACGGTATAGAGTTCCGTGCGTGTGATTTAAAAGGTGCCAACTTTTCCCGAACAAACTTTGCCCATCAAGTGAGTAATCGTATGTACTTTTGCTCAGCATTTATTTCTGGATGTAATCTTTCCTATGCCAATATGGAGAGGGTTTGTTTAGAAAAATGTGAGTTGTTTGAAAATCGCTGGATAGGAACGAACCTAGCGGGTGCATCACTGAAAGAGTCAGACTTAAGTCGAGGTGTTTTTTCCGAAGATGTCTGGGGGCAATTTAGCCTACAGGGTGCCAATTTATGCCACGCCGAACTCGACGGTTTAGATCACGCAAGTTAGCACGTCACAGG

4.8 Multiple Sequence Alignment

4.8.1 CLUSTAL 2.1 multiple sequence
alignment for 16Sr RNA gene

2     
–GGGGGGGCTTTGGCACGGTATTCCTCCAGATCTCTACGCATTTCACCGCTACACCTGG  58

4     
AGCCTTGTCATCATATCGTACTATTCTACTTATCTCTACGCATTTCACCGCTACACCTGG  60

1     
—AGACATCCCATCGCACGGTATTCTCCAGATCTCTACGCATTTCACCGCTACACCTGG  57

3     
—-AGGGGGCCTTGGCACGGTATTCTCCAGATCTCTACGCATTTCACCGCTACACCTGG  56

                              * ** *  *****************************

 

       2     
AATTCTACCCCCCTCTACGAGACTCAAGCTTGCCAGTATCAGATGCAGTTCCCAGGTTGA 118

4      AATTCTACCCCCCTCTACGAGACTCAAGCTTGCCAGTATCAGATGCAGTTCCCAGGTTGA  120

1     
AATTCTACCCCCCTCTACGAGACTCAAGCTTGCCAGTATCAGATGCAGTTCCCAGGTTGA  117

3     
AATTCTACCCCCCTCTACGAGACTCAAGCTTGCCAGTATCAGATGCAGTTCCCAGGTTGA  116

      
************************************************************

 

2     
GCCCGGGGATTTCACATCTGACTTAACAAACCGCCTGCGTGCGCTTTACGCCCAGTAATT  178

4     
GCCCGGGGATTTCACATCTGACTTAACAAACCGCCTGCGTGCGCTTTACGCCCAGTAATT  180

1     
GCCCGGGGATTTCACATCTGACTTAACAAACCGCCTGCGTGCGCTTTACGCCCAGTAATT  177

3     
GCCCGGGGATTTCACATCTGACTTAACAAACCGCCTGCGTGCGCTTTACGCCCAGTAATT  176

      
************************************************************

 

2     
CCAATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGGTGCT  238

4     
CCGATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGGTGCT  240

1     
CCGATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGGTGCT  237

3     
CCGATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGGTGCT  236

       **
*********************************************************

 

2     
TCTTCTGCGGGTAACGTCT-TGACCAAAGGTATTAACTTTACTCCCTTCCTCCCCGCTGA  297

4     
TCTTCTGCGGGTAACGTCAATGAGTAAAGGTATTAACTTTACTCCCTTCCTCCCCGCTGA  300

1     
TCTTCTGCGGGTAACGTCAATGAGCAAAGGTATTAACTTTACTCCCTTCCTCCCCGCTGA  297

3     
TCTTCTGCGGGTAACGTCAATGAGCAAAGGTATTAACTTTACTCCCTTCCTCCCCGCTGA  296

      
******************  ***  ***********************************

 

2     
AAGTACTTTACAACCAGAAGGCCTTCTTCATACACACGACATGGATGCATCAAGCTTGCG  357

4     
AAGTACTTTACAACCCGAAGGCCTTCTTCATACACGCGGCATGGCTGCATCAGGCTTGCG  360

1     
AAGTACTTTACAACCCGAAGGCCTTCTTCATACACGCGGCATGGCTGCATCAGGCTTGCG  357

3     
AAGTACTTTACAACCCGAAGGCCTTCTTCATACACGCGGCATGGCTGCATCAGGCTTGCG  356

      
*************** ******************* ** ***** ******* *******

 

2     
GCCCATTG—————————————————-  365

4      CCCATTGTGCAATATTCCCCACTGCTGCCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTC  420

1     
CCCATTGTGCAATATTCCCCACTGCTGCCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTC  417

3     
CCCATTGTGCAATATTCCCCACTGCTGCCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTC  416

       
**  *                                                      

 

2     
————————————————————  365

4     
CAGTGTGGCTGGTCATCCTCTCAGACCAGCTAGGGATCGTCGCCTAGGTGAGCCGTTACC  480

1     
CAGTGTGGCTGGTCATCCTCTCAGACCAGCTAGGGATCGTCGCCTAGGTGAGCCGTTACC  477

3     
CAGTGTGGCTGGTCATCCTCTCAGACCAGCTAGGGATCGTCGCCTAGGTGAGCCGTTACC  476

                                                                  

 

2     
————————————————————  365

4     
CCACCTACTAGCTAATCCCATCTGGGCACATCCGATGGCAAGAGGCCCGAAGGTCCCCCT  540

1     
CCACCTACGAGCTAAACCCATCTGGGCACATCCGATGGCAAGAA—————-  521

3     
CCACCTACTAGCTAATCCCATCTGGGCACATCCGATGGCAAGAGGCCCGAAGGTCCCCCT  536

                                                                  

 

2      ————————————————————  365

4     
CTTTGGTCTTGCGACGTTATGCGGTATTAGCTACCGTTTCCAGTAGTTATCCCCCTCCAT  600

1     
————————————————————  521

3     
CTTTGGTCTTGCGACGTTATGCGGTATTAGCTACCGTTTCCAGTAGTTATCCCCCTCCAT  596

                                                                  

 

2     
————————————————————  365

4     
CAGGCAGTTTCCCAGACATTACTCACCCGTCCGCCACTCGTCAGCGAAACAGCAAGCTGC  660

1     
————————————————————  521

3     
CAGGCAGTTTCCCAGACATTACTCACCCGTCCGCCACTCGTCAGCAAAGAAGCAAGCTTC  656

                                                                  

 

2     
—————————–     365

4     
TTCCTGTTACCGTTCGCTTTTGGCATGTA     689

1     
—————————–     521

3     
TTCCTGTTACCGTTCGACTTGCATGTAAA     685

                                   

4.8.2 CLUSTAL
2.1 multiple sequence alignment for TEM gene

      1      GGGTAAATAAAGATTGCTGAAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGA     602      CGCGAACCCACTGAAGCTAGGATATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGA     603      -GTTGAAGTAAAGGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGA     594      —-CGAAGAAAGCACTGCTGAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGA     565      —CGATTAGTAAGGATGCTGAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGA     57                            * ************************************* 1      TCTCAACAGCGGTAAG-ATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGA     1192      TCTCAACAGCGGTAAC-ATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGA     119

Related Posts

© All Right Reserved
x

Hi!
I'm Melba!

Would you like to get a custom essay? How about receiving a customized one?

Check it out